| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.058388 |
| Chromosome: | chromosome 14 |
| Location: | 2576835 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625750 | TIC22 | Putative chloroplast envelope protein; (1 of 1) PTHR33926:SF2 - PROTEIN TIC 22, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACAAGCGGCGGCGGATAAGTAGATTGTC |
| Internal bar code: | ACGGGTGCGTCGCGGGGACCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 99.7587 |
| LEAP-Seq n confirming: | 5789 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGCCCAAAAACTTCAGC |
| Suggested primer 2: | CGGTTTAGTTTGGGCTGGTA |