| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.058402 |
| Chromosome: | chromosome 9 |
| Location: | 3732464 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391171 | (1 of 4) 6.3.5.4 - Asparagine synthase (glutamine-hydrolyzing) / Glutamine-dependent asparagine synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACTCGCTTCCAAAACTCAAGCGGCCGA |
| Internal bar code: | ACTGAAAAGTCGGCGTGGAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 779 |
| LEAP-Seq percent confirming: | 97.3094 |
| LEAP-Seq n confirming: | 217 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGCAGTTGAGAATAGCA |
| Suggested primer 2: | TGAAGCATTTCAGGTTGCAG |