Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.058431 |
Chromosome: | chromosome 3 |
Location: | 7791905 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g203150 | (1 of 33) IPR013763 - Cyclin-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGCAACGTACGGCAGCACGTCTATCGC |
Internal bar code: | GTGGACGGTCGCTGGGTCGAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 602 |
LEAP-Seq percent confirming: | 99.7143 |
LEAP-Seq n confirming: | 349 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTGTGCACGGTGTTTACC |
Suggested primer 2: | CATGTTGGGTTGGTGACAAT |