Insertion junction: LMJ.RY0402.058446_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.058446
Chromosome:chromosome_3
Location:5004293
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g180450 FAP215,FPN1 5\'-nucleotidase and Flagellar Associated Protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ACTAGCGGTTCACACGGCATAAATACGACC
Internal bar code:AAATCGCACATATTCCTCAGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:686
LEAP-Seq percent confirming:97.9167
LEAP-Seq n confirming:47
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:ACAAGTACAAGGTGGCGGTC
Suggested primer 2:GTGCCCACCGTCCTAGTAAA