Insertion junction: LMJ.RY0402.058446_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.058446
Chromosome:chromosome_3
Location:5004305
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g180450 FAP215,FPN1 5\'-nucleotidase and Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GCCACCACTCACTTGTTGAGGCTCTTGCTG
Internal bar code:GCGTAGATACTAGATCGGTGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:632
LEAP-Seq percent confirming:99.4872
LEAP-Seq n confirming:776
LEAP-Seq n nonconfirming:4
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:GTGGACCATGTGTGCTTGTC
Suggested primer 2:ACAAGTACAAGGTGGCGGTC