| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.058547 |
| Chromosome: | chromosome 3 |
| Location: | 8990829 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g209505 | SNRK2E | snRK1 family in Chlamydomonas, subgroup 2; (1 of 6) K14498 - serine/threonine-protein kinase SRK2 (SNRK2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGACCGTCTGGCCGCCAGCCGTTGCAC |
| Internal bar code: | AGTAGCGCATCCAAGAGGTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 932 |
| LEAP-Seq percent confirming: | 97.8995 |
| LEAP-Seq n confirming: | 1072 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTATGGACCTACGCACG |
| Suggested primer 2: | GCATGTTCGTGTGTTTTTGG |