| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.058589 |
| Chromosome: | chromosome 12 |
| Location: | 3136559 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g499650 | (1 of 2) PF06127 - Protein of unknown function (DUF962) (DUF962) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCATAGGCATGGGCCACAGGTTGCAGCC |
| Internal bar code: | ATGTCGTTGGGGGTCAGGAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 293 |
| LEAP-Seq percent confirming: | 75.1058 |
| LEAP-Seq n confirming: | 887 |
| LEAP-Seq n nonconfirming: | 294 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATTCACAAGGGCAAAGTGG |
| Suggested primer 2: | GTGGTCAGGTGGAAAAGCAT |