| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.058595 |
| Chromosome: | chromosome 17 |
| Location: | 2627480 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g717150 | FAP263 | (1 of 1) PTHR15654:SF2 - COILED-COIL DOMAIN-CONTAINING PROTEIN 113; Flagellar Associated Protein 263 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTATCTCTGCACCTGAGCGCCTCTGCAG |
| Internal bar code: | GTGTGAGGCGCACGCCAGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 758 |
| LEAP-Seq percent confirming: | 98.3471 |
| LEAP-Seq n confirming: | 952 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGTCGTTGCCAAACTGCTG |
| Suggested primer 2: | TAGGAAGGCCTCAAAGAGCA |