| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.058643 |
| Chromosome: | chromosome 8 |
| Location: | 4154735 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g379950 | PFH17,P4H17,PHX12 | Prolyl 4-hydroxylase 17; (1 of 2) PTHR10869//PTHR10869:SF79 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACATGCACCTTTTGCTGTGCGCTGTCGTC |
| Internal bar code: | GCCCCGCATTATGAGTCGGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 86 |
| LEAP-Seq percent confirming: | 16.8043 |
| LEAP-Seq n confirming: | 346 |
| LEAP-Seq n nonconfirming: | 1713 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGTATGGCTTGGTCGGT |
| Suggested primer 2: | TCGTTCAGGTACACCAGCAG |