| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.058800 |
| Chromosome: | chromosome 2 |
| Location: | 1603893 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g085100 | CYG59 | (1 of 4) PTHR11920//PTHR11920:SF248 - ADENYLATE AND GUANYLATE CYCLASES // SUBFAMILY NOT NAMED; Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATCCTCACAGTCTACTTGCCATGCATC |
| Internal bar code: | TGTCCCGCGCTCTACGTCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 234 |
| LEAP-Seq percent confirming: | 66.1058 |
| LEAP-Seq n confirming: | 275 |
| LEAP-Seq n nonconfirming: | 141 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAACTACTGGCCCATCCCC |
| Suggested primer 2: | GCTTCCGCACTTCAAACTTC |