| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.058851 |
| Chromosome: | chromosome 10 |
| Location: | 1798781 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430950 | RAD54B,SRH18 | (1 of 1) K10875 - DNA repair and recombination protein RAD54 and RAD54-like protein (RAD54L, RAD54); SNF2-related DNA/RNA helicase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGAACAGGGCGATGGAGGAGCACACGTC |
| Internal bar code: | AGCCCGGGAGTTCTGTGGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 478 |
| LEAP-Seq percent confirming: | 86.1229 |
| LEAP-Seq n confirming: | 813 |
| LEAP-Seq n nonconfirming: | 131 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCATAACTGCATAAGGGC |
| Suggested primer 2: | TGGCTTCCCTATCCAGTACG |