| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.058891 |
| Chromosome: | chromosome 2 |
| Location: | 5180359 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105550 | (1 of 1) IPR000104//IPR003008 - Antifreeze protein, type I // Tubulin/FtsZ, GTPase domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTGGCTTGGGTTCAGCGCACAACATATG |
| Internal bar code: | TGTCCCCCCTGAGACGGGAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 611 |
| LEAP-Seq percent confirming: | 99.2674 |
| LEAP-Seq n confirming: | 271 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGATAGACTCCAGCACC |
| Suggested primer 2: | GACGGTAGCGTGACACTTGA |