| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.058893 |
| Chromosome: | chromosome 12 |
| Location: | 3929850 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g516250 | (1 of 25) PTHR10516 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTATTTTGTTTCAGCGCTTGAGATGCAAC |
| Internal bar code: | TTAACGAAGCCATCTAGCTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 873 |
| LEAP-Seq percent confirming: | 97.4011 |
| LEAP-Seq n confirming: | 2511 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACGCGTACCTTTATGCCG |
| Suggested primer 2: | TAGGTGGGTGGCGGTAAATA |