Insertion junction: LMJ.RY0402.058920_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.058920
Chromosome:chromosome_8
Location:4151435
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCTTGGCGGCGGCGGGACAGGCGGCGGGA
Internal bar code:TTGGCCTTAGCAATCGGGCTAC

Confirmation - LEAP-Seq

LEAP-Seq distance:710
LEAP-Seq percent confirming:65.7958
LEAP-Seq n confirming:3576
LEAP-Seq n nonconfirming:1859
LEAP-Seq n unique pos:31

Suggested primers for confirmation by PCR

Suggested primer 1:TTGTAACGACAGCTTGCGAC
Suggested primer 2:TTTTCCTGTGCTTTCCTGCT