Insertion junction: LMJ.RY0402.058920_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.058920
Chromosome:chromosome_8
Location:4152088
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CCAAGAAGTCTACCCTGTAACTCCAATAAT
Internal bar code:CTCTCCCGACGAGTATAGAATC

Confirmation - LEAP-Seq

LEAP-Seq distance:382
LEAP-Seq percent confirming:96.5517
LEAP-Seq n confirming:56
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:TGGTGGTCAGAACCAAAACA
Suggested primer 2:CTCGTCACCGTACGACAGAG