Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.058940 |
Chromosome: | chromosome 3 |
Location: | 5147395 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g182050 | LCS1 | (1 of 4) K01897 - long-chain acyl-CoA synthetase (ACSL, fadD); Long-chain acyl-CoA synthetase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGCAACAGCGCATTGGCGCAGGCCCAAG |
Internal bar code: | CCATCGGCCGCCCCGTCGCTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 932 |
LEAP-Seq percent confirming: | 99.4993 |
LEAP-Seq n confirming: | 4173 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGGCCTTTTGTTTCTTGG |
Suggested primer 2: | GCTGGTGTACATGATGGTGC |