Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.059000 |
Chromosome: | chromosome 1 |
Location: | 5570403 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g039550 | PLAP1,PLP1 | Plastid lipid associated protein 1; (1 of 230) IPR017986 - WD40-repeat-containing domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAAGCTTGTGCGCGCTGCAGCCACACC |
Internal bar code: | GGCGCCATCCGGGATGTTCTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 183 |
LEAP-Seq percent confirming: | 99.0085 |
LEAP-Seq n confirming: | 699 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTACTGGTGTTACCCCG |
Suggested primer 2: | TGACGAGGATGAAGACGATG |