Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.059106 |
Chromosome: | chromosome 6 |
Location: | 8214048 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g305600 | ADH9 | Alcohol dehydrogenase; (1 of 1) 1.1.1.329 - 2-deoxy-scyllo-inosamine dehydrogenase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGGTACCAGCGCCATCTTGGCGTCGTGC |
Internal bar code: | AATCGTCCTCAAACCAACACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 599 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 33 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAATGCAAGCTCCATCTCAA |
Suggested primer 2: | CTTGAGAGTTCCCTTGCTGG |