| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.059116 |
| Chromosome: | chromosome 2 |
| Location: | 488188 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076800 | ERG4 | Delta14-sterol reductase, mitochondrial; (1 of 1) 1.3.1.70 - Delta(14)-sterol reductase / Sterol C14-reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGATGAGACTTTTATCGTCGATCCCGC |
| Internal bar code: | GTTGGCCATCTGTACGTAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6 |
| LEAP-Seq percent confirming: | 99.7366 |
| LEAP-Seq n confirming: | 2272 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTGATTCACCTCACCCC |
| Suggested primer 2: | ACACACACACACACACACGG |