| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.059150 |
| Chromosome: | chromosome 7 |
| Location: | 5255786 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349100 | HEL39 | ATP-dependent RNA helicase; (1 of 1) K12813 - pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 (DHX16) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCTCTTGCGCTTGCATAATGCATCAAAG |
| Internal bar code: | GTTGTTTTTGCGAATATCATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 748 |
| LEAP-Seq percent confirming: | 99.5847 |
| LEAP-Seq n confirming: | 7433 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATCACGAGCTGGTGCTGAC |
| Suggested primer 2: | GTAGGGCGCATGAAGAATGT |