| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.059188 |
| Chromosome: | chromosome 2 |
| Location: | 5146860 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105287 | (1 of 1) PF13821 - Domain of unknown function (DUF4187) (DUF4187) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTCTAGCGGCTCGCTGCGTCCAGACCGG |
| Internal bar code: | GTTTGGATGTTTATCGGGCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 533 |
| LEAP-Seq percent confirming: | 98.0816 |
| LEAP-Seq n confirming: | 2812 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGAGTATTTCGGCTGTTGT |
| Suggested primer 2: | GTTTAGAGGGGCGTTTAGGG |