| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.059381 |
| Chromosome: | chromosome 14 |
| Location: | 196030 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608990 | (1 of 6) PTHR13339:SF0 - COP9 SIGNALOSOME COMPLEX SUBUNIT 8 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAGCTGCCCCTGGACCTGCCCTCGCTGG |
| Internal bar code: | AAGGTCCTCGTAGTGAGGCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 993 |
| LEAP-Seq percent confirming: | 97.7063 |
| LEAP-Seq n confirming: | 2641 |
| LEAP-Seq n nonconfirming: | 62 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGCTGCCTTATCATACCC |
| Suggested primer 2: | TACCTCCCCTGGTGAGTACG |