| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.059446 |
| Chromosome: | chromosome 4 |
| Location: | 1717648 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g212550 | TTL7 | (1 of 1) K06047 - tubulin---tyrosine ligase [EC:6.3.2.25] (TTL); Tubulin tyrosine ligase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGCTGTACGGTAGAGCGCTAGACTACC |
| Internal bar code: | TGACGTGGAGCGTTTGGGTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1040 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGATTTCCAACATTGGGTT |
| Suggested primer 2: | AGAGCGGCAGGTGCTAATAA |