| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.059476 |
| Chromosome: | chromosome 2 |
| Location: | 6144122 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g113500 | (1 of 1) IPR001322//IPR014867 - Lamin Tail Domain // Spore coat protein CotH | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTGGGAAGCAAACAGATTGCCACCCCAG |
| Internal bar code: | AGAGGGATGTCCCGCGCAGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 421 |
| LEAP-Seq percent confirming: | 96.8192 |
| LEAP-Seq n confirming: | 7701 |
| LEAP-Seq n nonconfirming: | 253 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACACGACTGAGATCCTGC |
| Suggested primer 2: | CCAAGTGCCAGTGTCAGAGA |