| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.059487 |
| Chromosome: | chromosome 16 |
| Location: | 1766377 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g655000 | PWR11 | (1 of 14) PF04720 - PDDEXK-like family of unknown function (PDDEXK_6); PWR motif protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCAGGCTGAGCTGCTTGGGGCATCGCAT |
| Internal bar code: | ATTTGGTGTATACGTAGATCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 359 |
| LEAP-Seq percent confirming: | 99.7393 |
| LEAP-Seq n confirming: | 8800 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGGTGCTGCTAAAGGTG |
| Suggested primer 2: | AAGCTGCTGCTTCAGCCTAC |