| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.059698 |
| Chromosome: | chromosome 5 |
| Location: | 1103904 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245950 | DRP1 | Dynamin-related GTPase; (1 of 2) PF01031//PF01926//PF02212 - Dynamin central region (Dynamin_M) // 50S ribosome-binding GTPase (MMR_HSR1) // Dynamin GTPase effector domain (GED) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTACGCATGCGGCTCTGGTGCTATCTG |
| Internal bar code: | TAACGGGTCGCACCTCAGCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 822 |
| LEAP-Seq percent confirming: | 99.4737 |
| LEAP-Seq n confirming: | 378 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCGTGAAAAGGTGCAAGT |
| Suggested primer 2: | AGACTTGGAAGTCCCCCAGT |