| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.059703 |
| Chromosome: | chromosome 9 |
| Location: | 4450027 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395658 | (1 of 52) 2.7.11.22 - Cyclin-dependent kinase / Cdk-activating protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAGAGCGCGCACGCCGAGGTTGTGTGCC |
| Internal bar code: | TTACGGGCACCCTTGTTTGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 99.6885 |
| LEAP-Seq n confirming: | 960 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGATAAGAGTTCGCACGGC |
| Suggested primer 2: | GACTGCATCACTACCCAGCA |