| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.059753 |
| Chromosome: | chromosome 13 |
| Location: | 4860928 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g605650 | ALDH10,ALDH10A1,ALD7 | (1 of 1) 1.2.1.8 - Betaine-aldehyde dehydrogenase / Betaine aldehyde oxidase; Aldehyde dehydrogenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGTGTGGGCACGTTTATTGCGAGTTGGG |
| Internal bar code: | CGCTAATTCCGCGCGGCTACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 694 |
| LEAP-Seq percent confirming: | 98.6834 |
| LEAP-Seq n confirming: | 1649 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGTGCTGAGGGTAAGCGA |
| Suggested primer 2: | AAGTACTGCAGGGTTGGGTG |