| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.059770 |
| Chromosome: | chromosome 10 |
| Location: | 1678371 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430050 | UBC20 | E2 Ubiquitin conjugating enzyme; (1 of 1) K10583 - ubiquitin-conjugating enzyme E2 S (UBE2S, E2EPF) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAGTAGCTGTAACCTGACCGCTCTACCC |
| Internal bar code: | TGTCGTTGTGCCGTGCCACTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1000 |
| LEAP-Seq percent confirming: | 99.4933 |
| LEAP-Seq n confirming: | 3142 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCGTTGTTGCATGAGAGC |
| Suggested primer 2: | CTGTTTTGCACTGCACCTGT |