| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.059828 |
| Chromosome: | chromosome 1 |
| Location: | 2174032 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g011901 | ARS7 | Arylsulfatase; (1 of 19) 3.1.6.1 - Arylsulfatase / Sulfatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGATTAGTGAACGGCCCCGGCGAGGGCA |
| Internal bar code: | TGGAACGCCCGCGGTCGGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 907 |
| LEAP-Seq percent confirming: | 95.3737 |
| LEAP-Seq n confirming: | 268 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAACCTGTGGGCTACAAAT |
| Suggested primer 2: | CAATGGAGCTCTGGATGGAT |