| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.059856 |
| Chromosome: | chromosome 14 |
| Location: | 621078 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612100 | RWP3 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGTTTTGGGCACCCAACCGGGTAGCAA |
| Internal bar code: | ATACAGTGGTTCTGTTCGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 464 |
| LEAP-Seq percent confirming: | 82.7065 |
| LEAP-Seq n confirming: | 2353 |
| LEAP-Seq n nonconfirming: | 492 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCATGACGTGCCTCTGAC |
| Suggested primer 2: | CCTGCTGCTAAGATTCCCTG |