Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.060169 |
Chromosome: | chromosome 7 |
Location: | 5741219 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g352900 | (1 of 1) PF00400//PF02141 - WD domain, G-beta repeat (WD40) // DENN (AEX-3) domain (DENN) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGAACGGGGAACGGCCCGGCAATTTGGG |
Internal bar code: | AGATCAGTGTCGACTGAATATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 358 |
LEAP-Seq percent confirming: | 99.8914 |
LEAP-Seq n confirming: | 920 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTGGTCACACTTCGACCC |
Suggested primer 2: | TACACGGGTCCCAGAAAGAG |