| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.060267 |
| Chromosome: | chromosome 3 |
| Location: | 1263770 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g150101 | NRT2D | Nitrate/nitrite transporter; (1 of 5) PTHR23515//PTHR23515:SF2 - FAMILY NOT NAMED // HIGH AFFINITY NITRATE TRANSPORTER 2.3-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAACTACGCAAATGCGGTAGTAATCGTTG |
| Internal bar code: | GGGCTGGAGCTAACAGGCCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 651 |
| LEAP-Seq percent confirming: | 99.4101 |
| LEAP-Seq n confirming: | 9775 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAATGCAAGCCAGCAATA |
| Suggested primer 2: | GCCGCATTGCTATTTTGATT |