Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.060295 |
Chromosome: | chromosome 7 |
Location: | 3448787 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g335400 | EttA | Putative soluble chloroplast ABCF protein, relatated to bacterial EttA which throttles translation speed; (1 of 1) PTHR19211:SF7 - ABC TRANSPORTER-RELATED PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACATGCATACAACTTCTCGTTTAGTTTCC |
Internal bar code: | AGCCTGGAATGGCATCACGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 894 |
LEAP-Seq percent confirming: | 97.8406 |
LEAP-Seq n confirming: | 3670 |
LEAP-Seq n nonconfirming: | 81 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGACGCACACAGACACAAGG |
Suggested primer 2: | TTGATCACCACGCACCTTTA |