| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.060304 |
| Chromosome: | chromosome 3 |
| Location: | 8128902 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g200750 | DMC1 | Putative DNA methylase; (1 of 1) IPR027417//IPR029063 - P-loop containing nucleoside triphosphate hydrolase // S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTGTGTCATGTTGATGTCGTATTTGTGG |
| Internal bar code: | TGGTGCTTGGGCGCTTAGCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 437 |
| LEAP-Seq percent confirming: | 99.1377 |
| LEAP-Seq n confirming: | 3794 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGACCTCGTATGCACGTAT |
| Suggested primer 2: | TAACTGACGGAGTCTCGGCT |