Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.060368 |
Chromosome: | chromosome 17 |
Location: | 4640783 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g733208 | (1 of 2) K13091 - RNA-binding protein 39 (RBM39, RNPC2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCGTGTTAAAGGCTAGACGGTCATGTG |
Internal bar code: | AGGGGGGGCAGTTAACAGAGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 520 |
LEAP-Seq percent confirming: | 98.8803 |
LEAP-Seq n confirming: | 3709 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCGATGATGACAACAACC |
Suggested primer 2: | CCAGACACGCATGAAATGAG |