Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.060385 |
Chromosome: | chromosome 16 |
Location: | 494299 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g693204 | FAP348 | Flagellar Associated Protein 348; (1 of 1) IPR001660//IPR002048//IPR013761 - Sterile alpha motif domain // EF-hand domain // Sterile alpha motif/pointed domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCTGGCGAGCCCTCATACAGCTGGCACA |
Internal bar code: | GGGATAGGACAACGGTCACCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 504 |
LEAP-Seq percent confirming: | 99.8624 |
LEAP-Seq n confirming: | 2902 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCTTGTTGAGGTTCATTT |
Suggested primer 2: | GTTTGAAGAGCGTAGGGCAG |