Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.060386 |
Chromosome: | chromosome 16 |
Location: | 5356604 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g681750 | FAP381 | Flagellar Associated Protein 381; (1 of 5) K01537 - Ca2+-transporting ATPase (E3.6.3.8) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCACCTTGATCTGGTCTGCCTCGCGCT |
Internal bar code: | AAAGGTCACGTACTTTAAACAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 469 |
LEAP-Seq percent confirming: | 92.3077 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAGTTAGGAAGCAGTGGC |
Suggested primer 2: | TACGCCATCACCATCACTGT |