| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.060391 |
| Chromosome: | chromosome 9 |
| Location: | 1756324 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396451 | GOX15 | (1 of 1) IPR011043//IPR014756//IPR015202 - Galactose oxidase/kelch, beta-propeller // Immunoglobulin E-set // Domain of unknown function DUF1929; Glyoxal oxidase 15 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGATCGACATTCTTGCGCCCCAGCTGT |
| Internal bar code: | TCCCGGGCAGCGCCTTCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1373 |
| LEAP-Seq percent confirming: | 99.7267 |
| LEAP-Seq n confirming: | 5473 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTGAACATGCCGTCCCT |
| Suggested primer 2: | TTCAGTAGTTGGCAATCCCC |