Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.060438 |
Chromosome: | chromosome 11 |
Location: | 3163330 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g479350 | (1 of 3) PTHR31563//PTHR31563:SF1 - FAMILY NOT NAMED // ION CHANNEL POLLUX-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAACACCGCAAAGGTGAAGATACCGGTG |
Internal bar code: | CCAGTGCTCGACGAAATAGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 939 |
LEAP-Seq percent confirming: | 98.7106 |
LEAP-Seq n confirming: | 2067 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTTTGTAGGTGAGGCAAT |
Suggested primer 2: | GGTGGTGTTCGGCAGTCTAT |