| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.060572 |
| Chromosome: | chromosome 2 |
| Location: | 5754035 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g110500 | (1 of 10) IPR004087//IPR004088 - K Homology domain // K Homology domain, type 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGTGGGCGTGTGCCTCACGCGAGAGC |
| Internal bar code: | AGCTTCCCTATGTTTCTCATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 590 |
| LEAP-Seq percent confirming: | 99.598 |
| LEAP-Seq n confirming: | 991 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGTGCATCAAGGCTGAC |
| Suggested primer 2: | CCCCTCTTATGGTCTCCCTC |