Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.060678 |
Chromosome: | chromosome 7 |
Location: | 3469301 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g335600 | NAR1D | Formate/nitrite transporter; (1 of 7) PTHR30520//PTHR30520:SF0 - FORMATE TRANSPORTER-RELATED // FORMATE TRANSPORTER 1-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATGGTAAACATGGGATGTGCTGGTGCG |
Internal bar code: | GCCAATTATGTTTGTCACAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 863 |
LEAP-Seq percent confirming: | 99.5796 |
LEAP-Seq n confirming: | 2132 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGAGCGACTGGCTTAATCA |
Suggested primer 2: | ATACCCTCCACTTGGCACAG |