| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.060870 |
| Chromosome: | chromosome 6 |
| Location: | 119672 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g249900 | FAP75 | (1 of 1) PTHR23359//PTHR23359:SF81 - NUCLEOTIDE KINASE // ADENYLATE KINASE 8; Flagellar Associated Protein 75 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAAGCACACGCCGTTGCTGCCCCCCCCC |
| Internal bar code: | GAGCCAAGTCGTTCTGAACCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 430 |
| LEAP-Seq percent confirming: | 97.9201 |
| LEAP-Seq n confirming: | 1177 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCTCTGACCTGTCCGCTC |
| Suggested primer 2: | CGCTGATGTTGAAACCACTG |