Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.060878 |
Chromosome: | chromosome 6 |
Location: | 7913400 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g303300 | CYN37 | (1 of 1) PTHR11071:SF174 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE CYP37, CHLOROPLASTIC; Cyclophilin 37 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGCGGCCCCGCACAACCCCATCGCCA |
Internal bar code: | GCTAGGTGCCGCTACCACCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 358 |
LEAP-Seq percent confirming: | 99.6325 |
LEAP-Seq n confirming: | 2711 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCGAGGTAAAGAAGATCC |
Suggested primer 2: | CACACTCGTGTAGTTCGCGT |