| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.060907 |
| Chromosome: | chromosome 7 |
| Location: | 2918373 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g332650 | NCT1 | (1 of 2) PTHR11662:SF3 - INNER MEMBRANE TRANSPORT PROTEIN RHMT; High-affinity nicotinic acid transporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGAGGCGAAGGCCAGGTTGGTTCGGTCG |
| Internal bar code: | AGTGAACTCGTGGCCCGTTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 631 |
| LEAP-Seq percent confirming: | 99.771 |
| LEAP-Seq n confirming: | 10454 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGCCTCCAGCTTTGATAG |
| Suggested primer 2: | ACACCTCCATCCTTCAAACG |