| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.060943 |
| Chromosome: | chromosome 17 |
| Location: | 4207261 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g730250 | PIT,PIT1 | (1 of 1) PTHR12175//PTHR12175:SF2 - AD039 HT014 THIOREDOXIN FAMILY TRP26 // SUBFAMILY NOT NAMED; Proteasome-interacting thioredoxin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTTGTCCTCCTGCTTCTTGATCTCCGCC |
| Internal bar code: | CATCCCAGAGTCGCATGCACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 707 |
| LEAP-Seq percent confirming: | 67.5906 |
| LEAP-Seq n confirming: | 2463 |
| LEAP-Seq n nonconfirming: | 1181 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGACCAGCTTTAATCCCAC |
| Suggested primer 2: | GTAGGCTTCTCTCCCTCGCT |