| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.061090 |
| Chromosome: | chromosome 11 |
| Location: | 383599 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467577 | (1 of 2) PF00319 - SRF-type transcription factor (DNA-binding and dimerisation domain) (SRF-TF) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAATGAGCTGCACACTGCGGGACTACGC |
| Internal bar code: | TTCCTACCCTGTCATTCGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 633 |
| LEAP-Seq percent confirming: | 99.7215 |
| LEAP-Seq n confirming: | 8235 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGACATAGCTGGCTAGGGG |
| Suggested primer 2: | ATACGGTAGCATGGGTCTGC |