| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.061177 |
| Chromosome: | chromosome 1 |
| Location: | 4706346 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032450 | (1 of 4) K06816 - golgi apparatus protein 1 (GLG1, ESL1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGCAGGTGGCGTCGCGCACGAGCTCCA |
| Internal bar code: | AATTGGAAGCTCGTGGCGCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 770 |
| LEAP-Seq percent confirming: | 99.6678 |
| LEAP-Seq n confirming: | 5100 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGTGAACGTCCCTTGAAT |
| Suggested primer 2: | CCGACTGCTCCTTGCTAAAC |