Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.061183 |
Chromosome: | chromosome 9 |
Location: | 7840736 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g416700 | Related to rhamnosyl methyltransferase; (1 of 10) PF13578 - Methyltransferase domain (Methyltransf_24) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGGCTCCATGACGGCGCTACTGGGTGT |
Internal bar code: | ATGGTATCGAGGGGCTGACGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 44 |
LEAP-Seq percent confirming: | 99.7537 |
LEAP-Seq n confirming: | 1215 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTTGGAATGCGTTCAATTT |
Suggested primer 2: | TCGAAATCTTGTGCAACAGC |