Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.061270 |
Chromosome: | chromosome 6 |
Location: | 7113594 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g297150 | RWP9 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTACTCCCTGCGCTACCATGTACAAATG |
Internal bar code: | ACTTTTTGCCGAGGACAGCTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 453 |
LEAP-Seq percent confirming: | 99.6705 |
LEAP-Seq n confirming: | 1815 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGAGTGGTGAACAAACAA |
Suggested primer 2: | ATAATTAACGGGGCGGTTTC |